Sequence ID | >WENV182325499 |
Genome ID | OHYS01018384 |
Search identical group | |
Phylum/Class | [OHYS] human gut metagenome; feces |
Species | |
Start position on genome | 932 |
End posion on genome | 1008 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
gcgcatgaag |
tRNA gene sequence |
GGGGGATTAGCTCAGCTGGCTAGAGCGCTTGCATGGCATGCAAGAGGTCACGAGTTCGAA |
Downstream region at tRNA end position |
taaaaacggg |
Secondary structure (Cloverleaf model) | >WENV182325499 Ala GGC g ACCA taaaaacggg G - C G - C G + T G - C G + T A - T T - A T A T T G C T C A C G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C C T A G AGGTC C - G T - A T - A G - C C - G A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |