Sequence ID | >W141230761 |
Genome ID | BATI01000016 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas alcaligenes NBRC 14159 [BATI] |
Start position on genome | 167835 |
End posion on genome | 167911 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
caacacatac |
tRNA gene sequence |
GCACCTGTAGCTCAGCTGGATAGAGTATTGCCCTCCGAAGGCAAGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tatcctcttg |
Secondary structure (Cloverleaf model) | >W141230761 Arg CCG c GCCA tatcctcttg G - C C - G A - T C - G C - G T - A G - C T A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC T - A T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |