| Sequence ID | >WENV182348637 |
| Genome ID | OIAZ01016054 |
| Phylum/Class | [OIAZ] human gut metagenome; feces |
| Species | |
| Start position on genome | 376 |
| End posion on genome | 300 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
cactggaaat |
| tRNA gene sequence |
GGGCGCATAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGTGGTTCGAA |
| Downstream region at tRNA end position |
gtcttctata |
| Secondary structure (Cloverleaf model) | >WENV182348637 Ile GAT
t ACCA gtcttctata
G - C
G - C
G - C
C - G
G + T
C - G
A - T T A
T T C A C C A
G G A A + | | | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
G - C
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |