Sequence ID | >WENV182354842 |
Genome ID | OIBO01002558 |
Search identical group | |
Phylum/Class | [OIBO] human gut metagenome; feces |
Species | |
Start position on genome | 445 |
End posion on genome | 516 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tatactttgt |
tRNA gene sequence |
AGGGGATTGGTCAAATGGTATGATAGGGGTCTCCAAAACCTTTGGTGGGAGTTCGATTCT |
Downstream region at tRNA end position |
tcaaaaagtg |
Secondary structure (Cloverleaf model) | >WENV182354842 Trp CCA t GCtc tcaaaaagtg A - T G - C G - C G - C G - C A - T T - A T T T C T C T C A A A G | + | | | G T A C T G G G G A G C G | | | + T T G T G A T T A A TGGT G + T G + T G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |