Sequence ID | >WENV182365127 |
Genome ID | OICI01008390 |
Search identical group | |
Phylum/Class | [OICI] human gut metagenome; feces |
Species | |
Start position on genome | 1668 |
End posion on genome | 1741 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtactcacat |
tRNA gene sequence |
GCCATCGTAGCTTAGTAGGTAGAGCGTTCGGCTGTTAACCGATTGGTCACAGGTTCGAGC |
Downstream region at tRNA end position |
ttgggcccat |
Secondary structure (Cloverleaf model) | >WENV182365127 Asn GTT t GCtt ttgggcccat G - C C - G C - G A - T T - A C - G G - C C G T T G T C C A T G A A | | | | | G A T T C G A C A G G C G + | | | T T G G A G C T A G TGGTC T T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |