Sequence ID | >WENV182384376 |
Genome ID | OIDU01010031 |
Search identical group | |
Phylum/Class | [OIDU] human gut metagenome; feces |
Species | |
Start position on genome | 778 |
End posion on genome | 705 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
acaaaggatt |
tRNA gene sequence |
GATTCGCTAGCTCAGCAGGTAGAGCACAACACTTTTAATGTTGGGGTCTTGGGTTCGAGC |
Downstream region at tRNA end position |
gaaaatcaga |
Secondary structure (Cloverleaf model) | >WENV182384376 Lys TTT t ACtt gaaaatcaga G - C A - T T - A T + G C - G G - C C - G C G T A A C C C A C G A A | | | | | G A C T C G T T G G G C G | | | | T T G G A G C T A A GGGTC C - G A - T A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |