Sequence ID | >C08004191 |
Genome ID | CP000830 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Dinoroseobacter shibae DFL 12 = DSM 16493 [CP000830] |
Start position on genome | 2515292 |
End posion on genome | 2515209 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
tccaaggcgt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGTAGACGCGCAGCGTTGAGGTCGCTGTGGGGTAACACCCGTG |
Downstream region at tRNA end position |
ttttcccccc |
Secondary structure (Cloverleaf model) | >C08004191 Leu GAG t Acca ttttcccccc G - C C - G G - C G - C T - A C - G G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TGGGGTAACACCCGT C - G A - T G - C C - G G - C T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |