Sequence ID | >WENV182393737 |
Genome ID | OIEI01000649 |
Search identical group | |
Phylum/Class | [OIEI] human gut metagenome; human gut |
Species | |
Start position on genome | 8186 |
End posion on genome | 8262 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aacagagtat |
tRNA gene sequence |
GGAGGATTAGCTCAGCTGGTTAGAGCACCTGCATCACACGCAGGGGGTCTGGGGTTCGAG |
Downstream region at tRNA end position |
aacgtaaggc |
Secondary structure (Cloverleaf model) | >WENV182393737 Val CAC t ACCA aacgtaaggc G - C G - C A - T G - C G + T A - T T - A T G T A T C C C A C G A A | + | | | G T C T C G T G G G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G T - A G - C C - G A C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |