Sequence ID | >WENV182395140 |
Genome ID | OIEK01001115 |
Search identical group | |
Phylum/Class | [OIEK] human gut metagenome; human gut |
Species | |
Start position on genome | 1832 |
End posion on genome | 1746 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
actaataaat |
tRNA gene sequence |
GGGGATGTGGCGAAATTGGCAGCCGCGCTAGATTTAGGTTCTAGTGGTGAAATATCCGTG |
Downstream region at tRNA end position |
aatttgatgt |
Secondary structure (Cloverleaf model) | >WENV182395140 Leu TAG t ACCA aatttgatgt G + T G - C G - C G - C A - T T - A G - C C C T C T C C C A T A A G | | | | G T A G C G G T G G G C G | | | T T G C C G C C A G G TGGTGAAATATCCGT C - G T - A A - T G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |