Sequence ID | >C08010144 |
Genome ID | CP000851 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Shewanella pealeana ATCC 700345 [CP000851] |
Start position on genome | 1774956 |
End posion on genome | 1775031 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tgcagtccgg |
tRNA gene sequence |
GTCCCCATCGTCTAGAGGCCTAGGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAAT |
Downstream region at tRNA end position |
ctatttataa |
Secondary structure (Cloverleaf model) | >C08010144 Glu TTC g ACCA ctatttataa G + T T - A C - G C - G C - G C - G A - T T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |