Sequence ID | >W141239639 |
Genome ID | CAES01000078 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Paenibacillus senegalensis JC66 [CAES] |
Start position on genome | 140516 |
End posion on genome | 140425 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
cattttattt |
tRNA gene sequence |
GGAGAGATACCCAAGTGGCTATAAGGGGACCCTCTGCTAAGGGGTTAGACTGCGTAAGTG |
Downstream region at tRNA end position |
tctttttttc |
Secondary structure (Cloverleaf model) | >W141239639 Ser GCT t GCCA tctttttttc G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A G T G A A | | | | | G G A C C C G A G G G C C | | | T T T A G G G A T A G TAGACTGCGTAAGTGGTGC A - T C - G C - G C - G T + G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |