Sequence ID | >WENV182418677 |
Genome ID | OIGH01004680 |
Search identical group | |
Phylum/Class | [OIGH] human gut metagenome; human gut |
Species | |
Start position on genome | 539 |
End posion on genome | 465 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
agacaaaaaa |
tRNA gene sequence |
GGGGCGTTAGCTCATCTGGCTAGAGCGTAACACTGGCAGTGTTAAGGTGATCGGTTCGAG |
Downstream region at tRNA end position |
acatcgcaga |
Secondary structure (Cloverleaf model) | >WENV182418677 Ala GGC a ACaa acatcgcaga G - C G - C G + T G - C C - G G - C T - A T G T T A G C C A C T A A | | | | | G T C T C G A T C G G C G | | | | T T G G A G C C T A G AGGTG T - A A - T A - T C - G A - T C G T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |