Sequence ID | >WENV182425674 |
Genome ID | OIHM01000025 |
Search identical group | |
Phylum/Class | [OIHM] human gut metagenome; human gut |
Species | |
Start position on genome | 42810 |
End posion on genome | 42736 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aacaaaacat |
tRNA gene sequence |
TCTTCCTTAGCTCAGTCGGTTAGAGCATCTGACTGTTAATCAGAGGGTCCTTGGTTCAAG |
Downstream region at tRNA end position |
aaaaaggttc |
Secondary structure (Cloverleaf model) | >WENV182425674 Asn GTT t GCaa aaaaaggttc T - A C - G T - A T - A C - G C - G T - A T G T G A A C C A T G A A | | | | | A C C T C G C T T G G C G | | | | T T G G A G C T T A A GGGTC T - A C - G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |