Sequence ID | >WENV182433917 |
Genome ID | OIIW01000171 |
Search identical group | |
Phylum/Class | [OIIW] human gut metagenome; human gut |
Species | |
Start position on genome | 5087 |
End posion on genome | 4996 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ctgaagatgt |
tRNA gene sequence |
GGAAAGATGGCTGAGTTGGTCTAAGGCGCACGACTGGAAATCGTGTAACGTGTCAAAAGC |
Downstream region at tRNA end position |
gaaaccccgg |
Secondary structure (Cloverleaf model) | >WENV182433917 Ser GGA t GCCA gaaaccccgg G - C G - C A - T A - T A - T G - C A - T T A T A C C C C A T T G A G | | | | | G G G T C G T G G G G C G + | | T T T A G G C C T A G TAACGTGTCAAAAGCGTTC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |