Sequence ID | >WENV182436809 |
Genome ID | OIJH01008231 |
Search identical group | |
Phylum/Class | [OIJH] human gut metagenome; human gut |
Species | |
Start position on genome | 531 |
End posion on genome | 446 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaggagtttt |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGATTGCGGCGGTCTTGAAAACCGTTGTACCGCGAGGTACC |
Downstream region at tRNA end position |
taaatgctga |
Secondary structure (Cloverleaf model) | >WENV182436809 Ser TGA t GCaa taaatgctga G - C G - C A - T G - C A - T G - C G + T T A T G T C C C A T G A G | + | | | G G G A C G C G G G G C G + | | | T T T T T G C C G A G TGTACCGCGAGGTACC G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |