Sequence ID | >WENV182439770 |
Genome ID | OIJW01000008 |
Search identical group | |
Phylum/Class | [OIJW] human gut metagenome; human gut |
Species | |
Start position on genome | 48966 |
End posion on genome | 49040 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaataaggat |
tRNA gene sequence |
GGTTCCGTAGCTCAGCTGGATAGAGCAACGCCCTTCTAAGGCGTGGGTCGAGCGTTCGAA |
Downstream region at tRNA end position |
gagtagaaac |
Secondary structure (Cloverleaf model) | >WENV182439770 Arg TCT t ACat gagtagaaac G - C G + T T - A T - A C - G C - G G - C T A T C T C G C A C G A A | | | | | G T C T C G G A G C G C G | | | | T T G G A G C A T A A GGGTC A - T C - G G - C C - G C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |