Sequence ID | >WENV182443336 |
Genome ID | OIKM01000215 |
Search identical group | |
Phylum/Class | [OIKM] human gut metagenome; human gut |
Species | |
Start position on genome | 400 |
End posion on genome | 318 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
catttagtga |
tRNA gene sequence |
GCGGATGTGGCGTAATTGGTAGCCGCGCCAGACTTAGGATCTGGTGTCTCGCGACGTGTA |
Downstream region at tRNA end position |
actttcaatg |
Secondary structure (Cloverleaf model) | >WENV182443336 Leu TAG a ACaa actttcaatg G - C C - G G - C G - C A - T T - A G - C T G T T A T C C A T A A G + | | | | G T T G C G G T A G G C G | | | T T G C C G C T A G G TGTCTCGCGACGT C - G C - G A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |