Sequence ID | >WENV182460690 |
Genome ID | OINQ01000122 |
Search identical group | |
Phylum/Class | [OINQ] human gut metagenome; human gut |
Species | |
Start position on genome | 183 |
End posion on genome | 109 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gagaaatgat |
tRNA gene sequence |
GGCGGGATAGCTCAGCTGGTTAGAGCGCATGATTCATAATCATGAGGTCCCCAGTTCAAT |
Downstream region at tRNA end position |
tgaacaattt |
Secondary structure (Cloverleaf model) | >WENV182460690 Met CAT t ACaa tgaacaattt G + T G - C C - G G - C G - C G - C A - T C T T G G G T C A C G A A | | | | | A T C T C G C C C A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T T - A G - C A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |