Sequence ID | >WENV182463206 |
Genome ID | OIOC01000047 |
Search identical group | |
Phylum/Class | [OIOC] human gut metagenome; human gut |
Species | |
Start position on genome | 31320 |
End posion on genome | 31232 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgaaccgaaa |
tRNA gene sequence |
GGAGAGGTGCAGGAGTGGTTGAACTGGCCCGCCTGGAAAGCGAGTAAACCCCTAAAGGGT |
Downstream region at tRNA end position |
gatgatccgc |
Secondary structure (Cloverleaf model) | >WENV182463206 Ser GGA a GCag gatgatccgc G - C G - C A - T G - C A - T G - C G - C T A T T C C C C A T G A G | | | | | G G G G A C A G G G G C G | | | T T T A C T G T G A G TAAACCCCTAAAGGGTTTC C - G C A C - G G - C C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |