Sequence ID | >WENV182484912 |
Genome ID | OIRN01007783 |
Search identical group | |
Phylum/Class | [OIRN] human gut metagenome; human gut |
Species | |
Start position on genome | 112 |
End posion on genome | 41 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ggagtcatct |
tRNA gene sequence |
GGCGCCATAGCCAAGTGGTAAGGCAAAGGTCTGCAACACCTCTATCACCAGTTCAAATCT |
Downstream region at tRNA end position |
ataaaaaggg |
Secondary structure (Cloverleaf model) | >WENV182484912 Cys GCA t TCtt ataaaaaggg G - C G - C C - G G - C C - G C - G A - T T A T T G G T C A G A A | | | | | A T A C C G A C C A G C G | | | T T G A G G C T A A TATC A C A - T G - C G - C T - A C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |