Sequence ID | >WENV182495536 |
Genome ID | OITB01000059 |
Search identical group | |
Phylum/Class | [OITB] human gut metagenome; human gut |
Species | |
Start position on genome | 13327 |
End posion on genome | 13400 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
gcggtatttt |
tRNA gene sequence |
CGGGGCATAGCGCAGTTGGTAGCGCGCCTCGTTCGGGACGAGGAGGCCGTGGGTTCAAAT |
Downstream region at tRNA end position |
aaaaaagcaa |
Secondary structure (Cloverleaf model) | >WENV182495536 Pro CGG t ACtt aaaaaagcaa C - G G - C G - C G + T G - C C - G A - T T A T C G C C C A T G A A | + | | | A T C G C G G T G G G C G | | | | T T G G C G C T A G AGGCC C - G C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |