Sequence ID | >WENV182500696 |
Genome ID | OITZ01001119 |
Search identical group | |
Phylum/Class | [OITZ] human gut metagenome; human gut |
Species | |
Start position on genome | 392 |
End posion on genome | 317 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cgttcattgt |
tRNA gene sequence |
GCTGGTGTAGCTCAGTCGGCAGAGCGTATCCTTGGTAAGGATAAGGTCACCGGTTCAATC |
Downstream region at tRNA end position |
tacatggcgg |
Secondary structure (Cloverleaf model) | >WENV182500696 Thr GGT t TCCA tacatggcgg G - C C - G T - A G + T G - C T - A G - C C T T T G G C C A T G A A | | | | | A C C T C G A C C G G C G | | | | T T G G A G C C A G AGGTC T - A A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |