Sequence ID | >WENV182503252 |
Genome ID | OIUO01000575 |
Search identical group | |
Phylum/Class | [OIUO] human gut metagenome; human gut |
Species | |
Start position on genome | 1748 |
End posion on genome | 1676 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aactcccata |
tRNA gene sequence |
GGTCCCGTGGTGTAGCGGTTATCACGTCGCCCTGTCACGGCGAAGATCGCGGGTTCGATT |
Downstream region at tRNA end position |
aagtagaaat |
Secondary structure (Cloverleaf model) | >WENV182503252 Asp GTC a Gttc aagtagaaat G - C G - C T - A C - G C - G C - G G - C T T T T G C C C A C G A G + | | | | G G T G T G G C G G G C G | | | T T T T C A C T A G AGATC T - A C - G G - C C - G C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |