Sequence ID | >WENV182507559 |
Genome ID | OIVM01002019 |
Search identical group | |
Phylum/Class | [OIVM] human gut metagenome; human gut |
Species | |
Start position on genome | 134 |
End posion on genome | 59 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
atcgtaccat |
tRNA gene sequence |
TCCTCGATAGCTCAGTCGGTAGAGCAATCGGCTGTTAACCGATCGGTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
atattggccc |
Secondary structure (Cloverleaf model) | >WENV182507559 Asn GTT t GCCA atattggccc T - A C - G C - G T + G C - G G - C A - T T G T C A T C C A T G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A CGGTC A - T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |