Sequence ID | >WENV182512253 |
Genome ID | OIWL01002577 |
Search identical group | |
Phylum/Class | [OIWL] human gut metagenome; faeces |
Species | |
Start position on genome | 4419 |
End posion on genome | 4344 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ataacaacgT |
tRNA gene sequence |
GCGCCCGTAGCTCAGGTGGATAGAGCAACTGCCTTCTAAGCAGTGGGCCGGGGGTTCGAG |
Downstream region at tRNA end position |
atgtggtgcc |
Secondary structure (Cloverleaf model) | >WENV182512253 Arg TCT T ATtg atgtggtgcc G - C C - G G - C C - G C - G C - G G - C T G T T T C C C A G G A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A GGGCC A - T C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |