Sequence ID | >WENV182515711 |
Genome ID | OIWN01002824 |
Search identical group | |
Phylum/Class | [OIWN] human gut metagenome; faeces |
Species | |
Start position on genome | 4518 |
End posion on genome | 4443 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
tccgtcgctt |
tRNA gene sequence |
GCAGGTGTAGCTCATCTGGTAGAGCGCCACCTTGCCAAGGTGGAGGTAGCGAGTTCGAGC |
Downstream region at tRNA end position |
gaaacgaaaa |
Secondary structure (Cloverleaf model) | >WENV182515711 Gly GCC t TCCA gaaacgaaaa G - C C - G A - T G - C G - C T - A G - C C G T T G C T C A C T A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G AGGTA C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |