Sequence ID | >WENV182523576 |
Genome ID | OIWS01020303 |
Search identical group | |
Phylum/Class | [OIWS] human gut metagenome; faeces |
Species | |
Start position on genome | 468 |
End posion on genome | 544 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ccaactacat |
tRNA gene sequence |
GACTCAGTAGCTCAGCTGGATAGAGCGTTTGACTACGAATCAAAAGGCCAGGGGTTCGAA |
Downstream region at tRNA end position |
aattaaagca |
Secondary structure (Cloverleaf model) | >WENV182523576 Arg ACG t ACCA aattaaagca G - C A - T C - G T + G C - G A - T G - C T A T T T C C C A C G A A | + | | | G T C T C G A G G G G C G | | | | T T G G A G C A T A G AGGCC T - A T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |