Sequence ID | >WENV182524999 |
Genome ID | OIWT01001026 |
Search identical group | |
Phylum/Class | [OIWT] human gut metagenome; faeces |
Species | |
Start position on genome | 420 |
End posion on genome | 495 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aagagtactt |
tRNA gene sequence |
GCCACTATAGCTCAGCTGGCAGAGCATCTCATTCGTAATGAGAGGGTCGTAGGTTCGAAT |
Downstream region at tRNA end position |
aatttaaagc |
Secondary structure (Cloverleaf model) | >WENV182524999 Thr CGT t TCCA aatttaaagc G - C C - G C - G A - T C - G T - A A - T T A T T A T C C A C G A A + | | | | G T C T C G G T A G G C G | | | | T T G G A G C C A A GGGTC T - A C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |