Sequence ID | >WENV182539738 |
Genome ID | OIXV01014741 |
Search identical group | |
Phylum/Class | [OIXV] human gut metagenome; faeces |
Species | |
Start position on genome | 1226 |
End posion on genome | 1317 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
agcgcaccgt |
tRNA gene sequence |
GGAGACGTGCCAGAGCGGCCGAATGGACTTCACTGCTAATGAAGGGTCGGGGTTAAACTC |
Downstream region at tRNA end position |
ctgaaagccc |
Secondary structure (Cloverleaf model) | >WENV182539738 Ser GCT t GCCA ctgaaagccc G - C G - C A - T G - C A - T C - G G - C T A T C C C C C A C G A G | | | | A G G A C C A G G G G C G | | | T T C A T G G C G A A GGTCGGGGTTAAACTCGACC C - G T - A T - A C - G A - T C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |