Sequence ID | >WENV182540190 |
Genome ID | OJAE01001801 |
Search identical group | |
Phylum/Class | [OJAE] seawater metagenome; Sea water |
Species | |
Start position on genome | 31 |
End posion on genome | 107 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gttacgcagt |
tRNA gene sequence |
CGGTGAGTGGCGCAGCTTGGTAGCGCACTTGTTTTGGGTACAAGGGGTCGTAGGTTCAAA |
Downstream region at tRNA end position |
ttttttgcaa |
Secondary structure (Cloverleaf model) | >WENV182540190 Pro TGG t ACCA ttttttgcaa C - G G - C G - C T - A G - C A - T G - C T A T T A T C C A C G A G + | | | | A T C G C G G T A G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C T - A T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |