Sequence ID | >WENV182540381 |
Genome ID | OJAJ01000019 |
Search identical group | |
Phylum/Class | [OJAJ] seawater metagenome; Sea water |
Species | |
Start position on genome | 1176 |
End posion on genome | 1250 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ttttgcacca |
tRNA gene sequence |
GGGGTGGTAGCTCAGCTGGTTAGAGCAGCGGACTCATAATCCGTCGGTCACGGGTTCAAG |
Downstream region at tRNA end position |
ggtcaaaatt |
Secondary structure (Cloverleaf model) | >WENV182540381 Ile2 CAT a ACag ggtcaaaatt G + T G - C G - C G - C T + G G - C G - C T G T T G C C C A C G A A | | | | | A T C T C G A C G G G C G | | | | T T G G A G C T T A A CGGTC G + T C - G G - C G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |