| Sequence ID | >WENV182541064 |
| Genome ID | OJAQ01005712 |
| Phylum/Class | [OJAQ] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 233 |
| End posion on genome | 158 |
| Amino Acid | Gly |
| Anticodon | TCC |
| Upstream region at tRNA start position |
agagaggtgt |
| tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTAGAGCATTAGTTTTCCAAACTAAATGTCGCGAGTTCGAAC |
| Downstream region at tRNA end position |
gtattaaaag |
| Secondary structure (Cloverleaf model) | >WENV182541064 Gly TCC
t TCCA gtattaaaag
G - C
C - G
G - C
G - C
G - C
T + G
G - C C A
T T G C T C A
T G A A + | | | | G
T C T C G G C G A G C
G | | | | T T
G G A G C
T A A ATGTC
T - A
T - A
A - T
G - C
T - A
T A
T A
T C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |