Sequence ID | >WENV182541901 |
Genome ID | OJAV01000006 |
Search identical group | |
Phylum/Class | [OJAV] seawater metagenome; Sea water |
Species | |
Start position on genome | 34878 |
End posion on genome | 34803 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gaccgagtgt |
tRNA gene sequence |
TGGGGTATAGCCAAGTTGGTAAGGCAGCGGGTTTTGATCCCGTTATTCCCAGGTTCGAGT |
Downstream region at tRNA end position |
ttttcttctg |
Secondary structure (Cloverleaf model) | >WENV182541901 Gln TTG t GCCA ttttcttctg T - A G - C G - C G - C G - C T - A A - T T G T G G T C C A T G A A | | | | | G T A C C G C C A G G C G | | | T T G A G G C T A A TATTC G + T C - G G - C G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |