Sequence ID | >WENV182542087 |
Genome ID | OJAV01002434 |
Search identical group | |
Phylum/Class | [OJAV] seawater metagenome; Sea water |
Species | |
Start position on genome | 4125 |
End posion on genome | 4039 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ntaccccgat |
tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACACAAGGGATTTAAAATCCCTCGCTGGTAACAGCGTG |
Downstream region at tRNA end position |
ttttatgatt |
Secondary structure (Cloverleaf model) | >WENV182542087 Leu TAA t ACCA ttttatgatt G - C C - G C - G C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | A T A G T G G C C G G C G | | | T T G A C A C T A G A CGCTGGTAACAGCGT A - T G - C G - C G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |