Sequence ID | >WENV182543673 |
Genome ID | OJBC01000186 |
Search identical group | |
Phylum/Class | [OJBC] seawater metagenome; Sea water |
Species | |
Start position on genome | 27617 |
End posion on genome | 27692 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gaacaaatac |
tRNA gene sequence |
CGGTCGTTAGCTCAGTTGGTAGAGCAGTTGGCTTTTAACCAATTTGTCGAAGGTTCAAAT |
Downstream region at tRNA end position |
cttttaattt |
Secondary structure (Cloverleaf model) | >WENV182543673 Lys TTT c ACCA cttttaattt C - G G - C G - C T - A C - G G - C T - A T A T C T T C C A T G A A | | | | | A T C T C G G A A G G C G | | | | T T G G A G C T A A TTGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |