Sequence ID | >WENV182545102 |
Genome ID | OJBM01000094 |
Search identical group | |
Phylum/Class | [OJBM] seawater metagenome; Sea water |
Species | |
Start position on genome | 344 |
End posion on genome | 269 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
agcagatgaa |
tRNA gene sequence |
GCGGCTGTAGCTCAGCTGGTAGAGCATCACGTTGCCAACGTGAATGTCACGAGTTCGAGT |
Downstream region at tRNA end position |
aattctgatg |
Secondary structure (Cloverleaf model) | >WENV182545102 Gly GCC a TCCA aattctgatg G - C C - G G - C G - C C - G T - A G + T T G T T G C T C A C G A A | | | | | G T C T C G A C G A G C G | | | | T T G G A G C T A A ATGTC T - A C - G A - T C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |