Sequence ID | >WENV182546880 |
Genome ID | OJBP01014507 |
Search identical group | |
Phylum/Class | [OJBP] seawater metagenome; Sea water |
Species | |
Start position on genome | 254 |
End posion on genome | 178 |
Amino Acid | Ile2 |
Anticodon | CAT |
Upstream region at tRNA start position |
ccgcgcaggc |
tRNA gene sequence |
GGGCCTGTAGCTCAATTGGTTAGAGCAGAGCGCTCATAACGCTTTGGTTGCGGGTTCAAG |
Downstream region at tRNA end position |
aatcccattt |
Secondary structure (Cloverleaf model) | >WENV182546880 Ile2 CAT c ACCA aatcccattt G + T G - C G - C C - G C - G T + G G - C T G T C G T C C A T A A A | | + | | A T C T C G G C G G G C G | | | | T T G G A G C T T A A TGGTT G + T A - T G - C C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |