Sequence ID | >WENV182547134 |
Genome ID | OJBR01001980 |
Search identical group | |
Phylum/Class | [OJBR] seawater metagenome; Sea water |
Species | |
Start position on genome | 2579 |
End posion on genome | 2505 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgcagaccgt |
tRNA gene sequence |
TCCGACGTAGCTCAGCGGTAGAGCAGTTGACTGTTAATCAATTGGTCGTAGGTTCGATCC |
Downstream region at tRNA end position |
acttcccctt |
Secondary structure (Cloverleaf model) | >WENV182547134 Asn GTT t GCCA acttcccctt T - A C - G C - G G - C A - T C - G G - C C T T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |