| Sequence ID | >WENV182547178 |
| Genome ID | OJBR01005074 |
| Phylum/Class | [OJBR] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 963 |
| End posion on genome | 888 |
| Amino Acid | Ala |
| Anticodon | TGC |
| Upstream region at tRNA start position |
cattgtaaat |
| tRNA gene sequence |
GGGGCCTTAGCTCAGCTGGGAGAGCGCCTGCCTTGCACGCAGGAGGTCAGCGGTTCGATC |
| Downstream region at tRNA end position |
atactgctgc |
| Secondary structure (Cloverleaf model) | >WENV182547178 Ala TGC
t ACCA atactgctgc
G - C
G - C
G + T
G - C
C - G
C - G
T - A C T
T T C G C C A
C G A A | | | | | G
T C T C G A G C G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
C - G
T - A
G - C
C - G
C C
T A
T G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |