Sequence ID | >WENV182547409 |
Genome ID | OJBS01002738 |
Search identical group | |
Phylum/Class | [OJBS] seawater metagenome; Sea water |
Species | |
Start position on genome | 1313 |
End posion on genome | 1240 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
gaatttatat |
tRNA gene sequence |
CGCGGGATAGAGCAGTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACTGGTTCGAGT |
Downstream region at tRNA end position |
agaaaacctc |
Secondary structure (Cloverleaf model) | >WENV182547409 fMet CAT t ACta agaaaacctc C T G - C C - G G - C G - C G - C A - T T G T T G A C C A T G A A | | | | | G A C G A G A C T G G C G | | | | T T G G C T C T A G AGGTC T - A C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |