Sequence ID | >WENV182549410 |
Genome ID | OJBY01000783 |
Search identical group | |
Phylum/Class | [OJBY] seawater metagenome; Sea water |
Species | |
Start position on genome | 12882 |
End posion on genome | 12966 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcgcttggtt |
tRNA gene sequence |
GCGGGCGTGGCGGAATTGGTAGACGCGCTGGTTTTAGGTACCAGTATCGCAAGATGTGGG |
Downstream region at tRNA end position |
atttcgcccc |
Secondary structure (Cloverleaf model) | >WENV182549410 Leu TAG t ACCA atttcgcccc G - C C - G G - C G - C G - C C - G G - C T G T T T C C C A T A A G + + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TATCGCAAGATGT C - G T - A G - C G - C T - A T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |