Sequence ID | >WENV182552862 |
Genome ID | OJCQ01001511 |
Search identical group | |
Phylum/Class | [OJCQ] seawater metagenome; Sea water |
Species | |
Start position on genome | 650 |
End posion on genome | 568 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tcgcattaaT |
tRNA gene sequence |
GGGTCGATGCCCGAGTGGTTAATGGGGGCGGACTGTAAATCCGCTGGCTTGCCTACACTG |
Downstream region at tRNA end position |
taaaagaatc |
Secondary structure (Cloverleaf model) | >WENV182552862 Tyr GTA T AAtt taaaagaatc G - C G - C G - C T + G C - G G - C A - T T A T T G A C C A T G A G | | | | | A G G C C C A C T G G C G + | | | T T T T G G G T A A G TGGCTTGCCTAC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |