Sequence ID | >WENV182553195 |
Genome ID | OJCR01000386 |
Search identical group | |
Phylum/Class | [OJCR] seawater metagenome; Sea water |
Species | |
Start position on genome | 6646 |
End posion on genome | 6719 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cagtagcttc |
tRNA gene sequence |
GGCCCCATCGTTTAGTGGCCTAGGACGCCGCCCTTTCACGGCGGTAGCACGGGTTCGAAT |
Downstream region at tRNA end position |
tataatttaa |
Secondary structure (Cloverleaf model) | >WENV182553195 Glu TTC c ACat tataatttaa G - C G + T C - G C - G C - G C - G A - T T A T T G C C C A T G A C | | | | | G G T T T G A C G G G C G + + | | T T C G G A C C T A G TAGC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |