Sequence ID | >WENV182555062 |
Genome ID | OJCY01001192 |
Search identical group | |
Phylum/Class | [OJCY] seawater metagenome; Sea water |
Species | |
Start position on genome | 719 |
End posion on genome | 644 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
acccttgtga |
tRNA gene sequence |
GCTGGCGTAGCTCAGTTGGTAGAGCAGCTGATTTGTAATCAGCCGGTCGGGGGTTCGACT |
Downstream region at tRNA end position |
attaataaac |
Secondary structure (Cloverleaf model) | >WENV182555062 Thr TGT a TCCA attaataaac G - C C - G T - A G - C G - C C - G G - C T C T T C T C C A T G A A + | + | | G T C T C G G G G G G C G | | | | T T G G A G C T A A CGGTC G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |