Sequence ID | >WENV182556266 |
Genome ID | OJDG01002751 |
Search identical group | |
Phylum/Class | [OJDG] seawater metagenome; Sea water |
Species | |
Start position on genome | 3769 |
End posion on genome | 3693 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttgcgcgtt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tattgaaaaa |
Secondary structure (Cloverleaf model) | >WENV182556266 Pro TGG t ACCA tattgaaaaa C - G G - C G - C G - C G - C T - A G - C T A T C T C T C A C G A A | + | | | G C T G C G G G G A G C T + | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |