Sequence ID | >WENV182558271 |
Genome ID | OJDL01028134 |
Search identical group | |
Phylum/Class | [OJDL] seawater metagenome; Sea water |
Species | |
Start position on genome | 507 |
End posion on genome | 580 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
aaggaattag |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGCAGAGCAGAAGCTTCCCAAGCTTACGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
gaatcgtcgg |
Secondary structure (Cloverleaf model) | >WENV182558271 Gly CCC g TCCA gaatcgtcgg G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C C A A CGAC G A A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |