| Sequence ID | >WENV182558502 |
| Genome ID | OJDM01007654 |
| Phylum/Class | [OJDM] seawater metagenome; Sea water |
| Species | |
| Start position on genome | 494 |
| End posion on genome | 420 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
ataaaggctt |
| tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCGCCACGTTTACACCGTGGATGCCGGGGGTTCGAG |
| Downstream region at tRNA end position |
aaattcaggc |
| Secondary structure (Cloverleaf model) | >WENV182558502 Val TAC
t ACaa aaattcaggc
G - C
G - C
G - C
C - G
C - G
T + G
G - C T G
T C T C C C A
T G A A | + | | | G
T C T C G G G G G G C
G | | | | T T
G G A G C
T T A G ATGCC
C - G
C - G
A - T
C - G
G - C
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |