Sequence ID | >WENV182560280 |
Genome ID | OJDT01023073 |
Search identical group | |
Phylum/Class | [OJDT] seawater metagenome; Sea water |
Species | |
Start position on genome | 77 |
End posion on genome | 3 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aatttatagt |
tRNA gene sequence |
TGGGATATCGCCAAGCGGTAAGGCACCAGGTTTTGATCCTGGCATTCCCAGGTTCAAATC |
Downstream region at tRNA end position |
acnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV182560280 Gln TTG t GCCA acnnnnnnnn T - A G - C G - C G - C A - T T - A A - T T A T G G T C C A G A C | | | | | A C A C C G C C A G G C G | | | T T G A G G C T A A CATTC C - G C - G A - T G - C G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |