Sequence ID | >WENV182563941 |
Genome ID | OJED01004487 |
Search identical group | |
Phylum/Class | [OJED] seawater metagenome; Sea water |
Species | |
Start position on genome | 271 |
End posion on genome | 195 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tggcctgagt |
tRNA gene sequence |
GGTCCCGTAGCTCAACTGGATAGAGCACCTGACTTCTAATCAGGATGTTGGGGGTTCGAG |
Downstream region at tRNA end position |
gacgcaccaa |
Secondary structure (Cloverleaf model) | >WENV182563941 Arg TCT t GCCA gacgcaccaa G - C G + T T - A C - G C - G C - G G - C T G T C C T C C A C A A A | | + | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A ATGTT C - G C - G T - A G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |