Sequence ID | >WENV182567016 |
Genome ID | OJEN01000497 |
Search identical group | |
Phylum/Class | [OJEN] seawater metagenome; Sea water |
Species | |
Start position on genome | 7933 |
End posion on genome | 7858 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ctccctcagt |
tRNA gene sequence |
GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTAGGTCCGCGGTTCGAGT |
Downstream region at tRNA end position |
ctttttccct |
Secondary structure (Cloverleaf model) | >WENV182567016 Thr TGT t ACCA ctttttccct G - C C - G C - G C - G C - G T + G A - T T G T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |